ID: 979032974

View in Genome Browser
Species Human (GRCh38)
Location 4:115675896-115675918
Sequence GATTTATGGTTGAGTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979032974_979032977 20 Left 979032974 4:115675896-115675918 CCTGGAGTACTCAACCATAAATC No data
Right 979032977 4:115675939-115675961 CAAAGGCTAAAGATTGAAGAAGG No data
979032974_979032976 3 Left 979032974 4:115675896-115675918 CCTGGAGTACTCAACCATAAATC No data
Right 979032976 4:115675922-115675944 GCATGCACGTAACAAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979032974 Original CRISPR GATTTATGGTTGAGTACTCC AGG (reversed) Intergenic
No off target data available for this crispr