ID: 979032976

View in Genome Browser
Species Human (GRCh38)
Location 4:115675922-115675944
Sequence GCATGCACGTAACAAAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979032973_979032976 18 Left 979032973 4:115675881-115675903 CCTTCAGAAAGTGTTCCTGGAGT No data
Right 979032976 4:115675922-115675944 GCATGCACGTAACAAAACAAAGG No data
979032974_979032976 3 Left 979032974 4:115675896-115675918 CCTGGAGTACTCAACCATAAATC No data
Right 979032976 4:115675922-115675944 GCATGCACGTAACAAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979032976 Original CRISPR GCATGCACGTAACAAAACAA AGG Intergenic
No off target data available for this crispr