ID: 979032977

View in Genome Browser
Species Human (GRCh38)
Location 4:115675939-115675961
Sequence CAAAGGCTAAAGATTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979032974_979032977 20 Left 979032974 4:115675896-115675918 CCTGGAGTACTCAACCATAAATC No data
Right 979032977 4:115675939-115675961 CAAAGGCTAAAGATTGAAGAAGG No data
979032975_979032977 6 Left 979032975 4:115675910-115675932 CCATAAATCAGAGCATGCACGTA No data
Right 979032977 4:115675939-115675961 CAAAGGCTAAAGATTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979032977 Original CRISPR CAAAGGCTAAAGATTGAAGA AGG Intergenic
No off target data available for this crispr