ID: 979033711

View in Genome Browser
Species Human (GRCh38)
Location 4:115684529-115684551
Sequence CTCCATATTACACTTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979033711_979033714 11 Left 979033711 4:115684529-115684551 CCTGTAAAAAGTGTAATATGGAG No data
Right 979033714 4:115684563-115684585 CCAAATATATTATGATCTGTGGG No data
979033711_979033712 10 Left 979033711 4:115684529-115684551 CCTGTAAAAAGTGTAATATGGAG No data
Right 979033712 4:115684562-115684584 GCCAAATATATTATGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979033711 Original CRISPR CTCCATATTACACTTTTTAC AGG (reversed) Intergenic
No off target data available for this crispr