ID: 979041244

View in Genome Browser
Species Human (GRCh38)
Location 4:115799397-115799419
Sequence CTTTCTCTCAACATGCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979041243_979041244 -4 Left 979041243 4:115799378-115799400 CCAGTGCTTATTATCTATTCTTT No data
Right 979041244 4:115799397-115799419 CTTTCTCTCAACATGCAATCAGG No data
979041242_979041244 -3 Left 979041242 4:115799377-115799399 CCCAGTGCTTATTATCTATTCTT No data
Right 979041244 4:115799397-115799419 CTTTCTCTCAACATGCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979041244 Original CRISPR CTTTCTCTCAACATGCAATC AGG Intergenic
No off target data available for this crispr