ID: 979043678

View in Genome Browser
Species Human (GRCh38)
Location 4:115834524-115834546
Sequence CTGACTTCAGACTGCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979043678_979043683 1 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043683 4:115834548-115834570 CTGGGACTCTCGAGCTTGGTAGG No data
979043678_979043690 10 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043690 4:115834557-115834579 TCGAGCTTGGTAGGGGGGAGGGG No data
979043678_979043686 4 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043686 4:115834551-115834573 GGACTCTCGAGCTTGGTAGGGGG No data
979043678_979043687 5 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043687 4:115834552-115834574 GACTCTCGAGCTTGGTAGGGGGG No data
979043678_979043689 9 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043689 4:115834556-115834578 CTCGAGCTTGGTAGGGGGGAGGG No data
979043678_979043684 2 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043684 4:115834549-115834571 TGGGACTCTCGAGCTTGGTAGGG No data
979043678_979043681 -3 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043681 4:115834544-115834566 CAGCCTGGGACTCTCGAGCTTGG No data
979043678_979043691 28 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043691 4:115834575-115834597 AGGGGAGACTGCTATTACTGAGG No data
979043678_979043685 3 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043685 4:115834550-115834572 GGGACTCTCGAGCTTGGTAGGGG No data
979043678_979043688 8 Left 979043678 4:115834524-115834546 CCAGCGCAGCAGTCTGAAGTCAG No data
Right 979043688 4:115834555-115834577 TCTCGAGCTTGGTAGGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979043678 Original CRISPR CTGACTTCAGACTGCTGCGC TGG (reversed) Intergenic
No off target data available for this crispr