ID: 979048927

View in Genome Browser
Species Human (GRCh38)
Location 4:115904848-115904870
Sequence ATGTTGAAGGAGAATGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979048920_979048927 21 Left 979048920 4:115904804-115904826 CCTTCCTATCTATATTCCTTTTA No data
Right 979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG No data
979048921_979048927 17 Left 979048921 4:115904808-115904830 CCTATCTATATTCCTTTTATTTC No data
Right 979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG No data
979048924_979048927 -5 Left 979048924 4:115904830-115904852 CCTGCACTAGTTAAGGAGATGTT No data
Right 979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG No data
979048922_979048927 5 Left 979048922 4:115904820-115904842 CCTTTTATTTCCTGCACTAGTTA No data
Right 979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979048927 Original CRISPR ATGTTGAAGGAGAATGAAGA GGG Intergenic
No off target data available for this crispr