ID: 979058031

View in Genome Browser
Species Human (GRCh38)
Location 4:116018946-116018968
Sequence GCTTCCAGAGTTACCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979058031_979058033 8 Left 979058031 4:116018946-116018968 CCTGCTCTGGTAACTCTGGAAGC No data
Right 979058033 4:116018977-116018999 CTATGTACAGCTGAAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979058031 Original CRISPR GCTTCCAGAGTTACCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr