ID: 979058036

View in Genome Browser
Species Human (GRCh38)
Location 4:116019010-116019032
Sequence GCTTCCGGGGTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979058036_979058042 18 Left 979058036 4:116019010-116019032 CCTGCTCTAGTCACCCCGGAAGC No data
Right 979058042 4:116019051-116019073 CCAAAGCTTGAGTCATCATCAGG No data
979058036_979058043 19 Left 979058036 4:116019010-116019032 CCTGCTCTAGTCACCCCGGAAGC No data
Right 979058043 4:116019052-116019074 CAAAGCTTGAGTCATCATCAGGG No data
979058036_979058040 -5 Left 979058036 4:116019010-116019032 CCTGCTCTAGTCACCCCGGAAGC No data
Right 979058040 4:116019028-116019050 GAAGCTGACTAGTCTACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979058036 Original CRISPR GCTTCCGGGGTGACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr