ID: 979063390 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:116097079-116097101 |
| Sequence | CTGGGCAGTGTGAAGATGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 979063390_979063397 | 21 | Left | 979063390 | 4:116097079-116097101 | CCCTCCATCTTCACACTGCCCAG | No data | ||
| Right | 979063397 | 4:116097123-116097145 | ATATTTTAAAAGCTTTCTCTAGG | No data | ||||
| 979063390_979063398 | 24 | Left | 979063390 | 4:116097079-116097101 | CCCTCCATCTTCACACTGCCCAG | No data | ||
| Right | 979063398 | 4:116097126-116097148 | TTTTAAAAGCTTTCTCTAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 979063390 | Original CRISPR | CTGGGCAGTGTGAAGATGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||