ID: 979063390

View in Genome Browser
Species Human (GRCh38)
Location 4:116097079-116097101
Sequence CTGGGCAGTGTGAAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979063390_979063397 21 Left 979063390 4:116097079-116097101 CCCTCCATCTTCACACTGCCCAG No data
Right 979063397 4:116097123-116097145 ATATTTTAAAAGCTTTCTCTAGG No data
979063390_979063398 24 Left 979063390 4:116097079-116097101 CCCTCCATCTTCACACTGCCCAG No data
Right 979063398 4:116097126-116097148 TTTTAAAAGCTTTCTCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979063390 Original CRISPR CTGGGCAGTGTGAAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr