ID: 979065672

View in Genome Browser
Species Human (GRCh38)
Location 4:116129489-116129511
Sequence CAGAATAATTTAATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979065672_979065674 1 Left 979065672 4:116129489-116129511 CCTCTCTCCATTAAATTATTCTG No data
Right 979065674 4:116129513-116129535 CATTTGAATGCCAGATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979065672 Original CRISPR CAGAATAATTTAATGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr