ID: 979072530

View in Genome Browser
Species Human (GRCh38)
Location 4:116226993-116227015
Sequence CTGAATATTCAAATAGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979072528_979072530 10 Left 979072528 4:116226960-116226982 CCAAGACTGCAAATAGTATATAG No data
Right 979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG No data
979072527_979072530 27 Left 979072527 4:116226943-116226965 CCAGCTAGTGAGTAGAGCCAAGA No data
Right 979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979072530 Original CRISPR CTGAATATTCAAATAGCCAA AGG Intergenic
No off target data available for this crispr