ID: 979076404

View in Genome Browser
Species Human (GRCh38)
Location 4:116276136-116276158
Sequence TATAATCCTGTATTTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979076404_979076408 23 Left 979076404 4:116276136-116276158 CCTCCAAGAAATACAGGATTATA No data
Right 979076408 4:116276182-116276204 ATTGGTGTCCCTAAAAGAGATGG No data
979076404_979076406 5 Left 979076404 4:116276136-116276158 CCTCCAAGAAATACAGGATTATA No data
Right 979076406 4:116276164-116276186 ATACCAAATCTATGACTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979076404 Original CRISPR TATAATCCTGTATTTCTTGG AGG (reversed) Intergenic
No off target data available for this crispr