ID: 979082525

View in Genome Browser
Species Human (GRCh38)
Location 4:116361134-116361156
Sequence CATCAGAGCCTGACCGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979082525_979082538 22 Left 979082525 4:116361134-116361156 CCCACCACGGTCAGGCTCTGATG No data
Right 979082538 4:116361179-116361201 TATGAGTCTGTGGGTACACAGGG No data
979082525_979082536 13 Left 979082525 4:116361134-116361156 CCCACCACGGTCAGGCTCTGATG No data
Right 979082536 4:116361170-116361192 CTGGGAGTTTATGAGTCTGTGGG No data
979082525_979082530 -5 Left 979082525 4:116361134-116361156 CCCACCACGGTCAGGCTCTGATG No data
Right 979082530 4:116361152-116361174 TGATGGACTTTGTGCCCCCTGGG No data
979082525_979082529 -6 Left 979082525 4:116361134-116361156 CCCACCACGGTCAGGCTCTGATG No data
Right 979082529 4:116361151-116361173 CTGATGGACTTTGTGCCCCCTGG No data
979082525_979082539 25 Left 979082525 4:116361134-116361156 CCCACCACGGTCAGGCTCTGATG No data
Right 979082539 4:116361182-116361204 GAGTCTGTGGGTACACAGGGTGG No data
979082525_979082535 12 Left 979082525 4:116361134-116361156 CCCACCACGGTCAGGCTCTGATG No data
Right 979082535 4:116361169-116361191 CCTGGGAGTTTATGAGTCTGTGG No data
979082525_979082537 21 Left 979082525 4:116361134-116361156 CCCACCACGGTCAGGCTCTGATG No data
Right 979082537 4:116361178-116361200 TTATGAGTCTGTGGGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979082525 Original CRISPR CATCAGAGCCTGACCGTGGT GGG (reversed) Intergenic
No off target data available for this crispr