ID: 979082762

View in Genome Browser
Species Human (GRCh38)
Location 4:116363183-116363205
Sequence AGCAGCCACTGGATGTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979082762_979082767 22 Left 979082762 4:116363183-116363205 CCAAAAGACATCCAGTGGCTGCT No data
Right 979082767 4:116363228-116363250 TCTAGAATGTATTAATTTTGTGG No data
979082762_979082764 -1 Left 979082762 4:116363183-116363205 CCAAAAGACATCCAGTGGCTGCT No data
Right 979082764 4:116363205-116363227 TCCTTCCGCTTCTTTCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979082762 Original CRISPR AGCAGCCACTGGATGTCTTT TGG (reversed) Intergenic
No off target data available for this crispr