ID: 979083497

View in Genome Browser
Species Human (GRCh38)
Location 4:116374565-116374587
Sequence CAAGGGGAACAATAGTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979083497_979083501 -3 Left 979083497 4:116374565-116374587 CCAATGTACTATTGTTCCCCTTG No data
Right 979083501 4:116374585-116374607 TTGCCTTTTTTGAGTTTACAAGG No data
979083497_979083502 -2 Left 979083497 4:116374565-116374587 CCAATGTACTATTGTTCCCCTTG No data
Right 979083502 4:116374586-116374608 TGCCTTTTTTGAGTTTACAAGGG No data
979083497_979083504 9 Left 979083497 4:116374565-116374587 CCAATGTACTATTGTTCCCCTTG No data
Right 979083504 4:116374597-116374619 AGTTTACAAGGGTGCCGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979083497 Original CRISPR CAAGGGGAACAATAGTACAT TGG (reversed) Intergenic
No off target data available for this crispr