ID: 979085433

View in Genome Browser
Species Human (GRCh38)
Location 4:116404287-116404309
Sequence TAGGGAATACAGAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979085429_979085433 0 Left 979085429 4:116404264-116404286 CCTACGGGATAATAACAAGTTTA No data
Right 979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979085433 Original CRISPR TAGGGAATACAGAAGGAGAG AGG Intergenic
No off target data available for this crispr