ID: 979087836

View in Genome Browser
Species Human (GRCh38)
Location 4:116436331-116436353
Sequence CTTTTGTTCTGAAGGAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979087833_979087836 26 Left 979087833 4:116436282-116436304 CCATTGTTATTGTATAATAAGCA No data
Right 979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979087836 Original CRISPR CTTTTGTTCTGAAGGAGAAA TGG Intergenic
No off target data available for this crispr