ID: 979089280

View in Genome Browser
Species Human (GRCh38)
Location 4:116459527-116459549
Sequence GGTCTCAAGGGAGCACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979089275_979089280 -10 Left 979089275 4:116459514-116459536 CCTCCCATTTTCGGGTCTCAAGG No data
Right 979089280 4:116459527-116459549 GGTCTCAAGGGAGCACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979089280 Original CRISPR GGTCTCAAGGGAGCACACCC TGG Intergenic
No off target data available for this crispr