ID: 979099579

View in Genome Browser
Species Human (GRCh38)
Location 4:116598655-116598677
Sequence CGATCCTCTGGGCCTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979099579_979099582 5 Left 979099579 4:116598655-116598677 CCACAAGGAGGCCCAGAGGATCG No data
Right 979099582 4:116598683-116598705 CGCAACCACATCAAGCTGTCAGG 0: 1
1: 1
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979099579 Original CRISPR CGATCCTCTGGGCCTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr