ID: 979099586

View in Genome Browser
Species Human (GRCh38)
Location 4:116598714-116598736
Sequence CTGTGGGGTGACGGTGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 376}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979099586_979099598 14 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099598 4:116598751-116598773 GTGGGGGAAGGTGCAGCAGCTGG 0: 1
1: 0
2: 5
3: 87
4: 865
979099586_979099596 2 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099596 4:116598739-116598761 CATCAACTCCAAGTGGGGGAAGG 0: 1
1: 1
2: 2
3: 14
4: 166
979099586_979099593 -4 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099593 4:116598733-116598755 ACAGATCATCAACTCCAAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 120
979099586_979099592 -5 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099592 4:116598732-116598754 CACAGATCATCAACTCCAAGTGG 0: 1
1: 0
2: 2
3: 12
4: 164
979099586_979099595 -2 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099595 4:116598735-116598757 AGATCATCAACTCCAAGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
979099586_979099600 26 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099600 4:116598763-116598785 GCAGCAGCTGGTGCCAAAACGGG No data
979099586_979099599 25 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099599 4:116598762-116598784 TGCAGCAGCTGGTGCCAAAACGG No data
979099586_979099594 -3 Left 979099586 4:116598714-116598736 CCTACACCACCGTCACCCCACAG 0: 1
1: 0
2: 4
3: 54
4: 376
Right 979099594 4:116598734-116598756 CAGATCATCAACTCCAAGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979099586 Original CRISPR CTGTGGGGTGACGGTGGTGT AGG (reversed) Intergenic
900503952 1:3019875-3019897 CTGCGGGGTGACCTTGATGTGGG + Intergenic
900973607 1:6004927-6004949 CTGAGGGGTGAGGGTGGAGTGGG + Intronic
900973626 1:6005006-6005028 CTAAGGGGTGAGGGTGGAGTAGG + Intronic
900973640 1:6005046-6005068 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973650 1:6005085-6005107 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973662 1:6005125-6005147 CTGAGGGGTGAGGGTGCAGTGGG + Intronic
900973674 1:6005165-6005187 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973686 1:6005205-6005227 CTGAGGGGTGAGGGTGGAGTAGG + Intronic
900973698 1:6005245-6005267 CTGAGGGGTGGGGGTGGAGTTGG + Intronic
900973710 1:6005285-6005307 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973720 1:6005324-6005346 CTGAGGGGTGAGGGTAGAGTGGG + Intronic
900973752 1:6005443-6005465 CTGAGGGGTGAGGGTGGAGGCGG + Intronic
900973886 1:6005925-6005947 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973895 1:6005964-6005986 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973904 1:6006003-6006025 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973917 1:6006043-6006065 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973926 1:6006082-6006104 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973939 1:6006122-6006144 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973952 1:6006162-6006184 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973961 1:6006201-6006223 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973970 1:6006240-6006262 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973983 1:6006280-6006302 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900973992 1:6006319-6006341 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974005 1:6006359-6006381 CTGAGGGGTGGGGGTGGAGTGGG - Intronic
900974020 1:6006399-6006421 TTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974029 1:6006438-6006460 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974042 1:6006478-6006500 CTGAGGGGTGAGGGTGCAGTGGG - Intronic
900974074 1:6006581-6006603 CTGAGGGGTGAGGGTGAAGTGGG - Intronic
900974086 1:6006621-6006643 CTGAGGGGTGAGGGTGGAGTGGG - Intronic
900974120 1:6006740-6006762 CTGAGGGGTGAGGGTGGAGTAGG - Intronic
901466447 1:9424560-9424582 GGGTGGGGTGAAGGTGGTGGAGG + Intergenic
902246860 1:15126545-15126567 CTGTGCTGTCAGGGTGGTGTTGG - Intergenic
902835661 1:19045207-19045229 CTGAGGGGTGGCGGTGATGGTGG - Intergenic
903649909 1:24916128-24916150 CTGTGGGGTGAAGTGGGAGTAGG - Intronic
904326465 1:29729758-29729780 CTGTGGGGTGAGAGAGGTGTGGG + Intergenic
905623673 1:39471908-39471930 CTGTGGATGGACGGTGGTGACGG - Intronic
905786475 1:40761916-40761938 ATGGGGGGTGGCGGGGGTGTGGG - Intronic
907936162 1:59044088-59044110 ATGTGGGGTGAGGGTGGGGAAGG + Intergenic
908551234 1:65210606-65210628 ATGTTGGGTGATGGTGGTGGTGG + Intronic
909388756 1:75092462-75092484 CTGTGGGGCGGCGGGGGGGTGGG + Intergenic
910669296 1:89757090-89757112 CAGTGGGGTGAGGATGGTCTGGG - Intronic
911924874 1:103817355-103817377 CACTGGGGTGAGGGTGGTGGTGG - Intergenic
912361673 1:109100627-109100649 CTGCGGGCTGCCGGTGGCGTAGG + Intergenic
912500744 1:110120504-110120526 GTGTGTGGTGATGGTGGTGGCGG - Intergenic
913550797 1:119915550-119915572 CTGTGCTGTGAAGGGGGTGTGGG + Exonic
914733918 1:150398110-150398132 CTGCGGGGTGGGGGTGGGGTGGG - Intronic
915126079 1:153666001-153666023 CTTTGGGGTGATGGGGATGTAGG + Intronic
915129806 1:153688438-153688460 GTGTGGGGTGTCGATGGTGGAGG - Intronic
916324374 1:163540515-163540537 CTGTCGGGGGAGGGTGGTGGGGG + Intergenic
917851594 1:179069224-179069246 CTGTGGGTCAATGGTGGTGTTGG - Intronic
918546774 1:185693558-185693580 CTGGGGGGTGAGGGTGGGATGGG + Intergenic
918852594 1:189711151-189711173 CTGTGGATTGAGGGTGATGTTGG - Intergenic
919918560 1:202154117-202154139 GTGTGGGGTGGGGGTGGGGTGGG + Intronic
920128186 1:203710514-203710536 CTGTGTGGTGCTGGTGGTTTGGG - Intronic
920302121 1:204995521-204995543 CTGTGGGTTGACCGGGGTTTGGG + Intronic
920865731 1:209751813-209751835 CTTGGGGGTGAAGGTGGGGTAGG - Intergenic
922958210 1:229623432-229623454 CTGAGGGGAGAAGGTGGAGTGGG - Intronic
924146375 1:241079805-241079827 CTATGGGGTGAGGGTGGGGATGG - Intronic
924938644 1:248793820-248793842 TTGTGGGATGATGGTGGTTTTGG - Intergenic
1062879211 10:964774-964796 CTGTGGGGTGCCGGGGCTGCGGG + Intergenic
1064015926 10:11772356-11772378 CTGTGGGGTGAGGGCTGTGGTGG - Intergenic
1064131559 10:12714200-12714222 GTGGGGGGTGACGGTGGGGTCGG - Intronic
1067307314 10:45076401-45076423 CTCTGGAGTGACAGTGGAGTAGG + Intergenic
1067691967 10:48507897-48507919 CTGGGGGGTGGGGGTGGGGTGGG + Intronic
1069518690 10:69100683-69100705 CTGTGGGGTGGGGGTGGCGGTGG + Intronic
1069574724 10:69518355-69518377 CTCTGGGGTGGCGGGGGTGTTGG - Intergenic
1069702866 10:70439358-70439380 CTGTCTGGGGACGGCGGTGTCGG - Intronic
1071847854 10:89537960-89537982 CTGTGGGTTGATGATGGTGATGG + Intronic
1073726517 10:106237337-106237359 CTGTGGGGTGAGGGAAGGGTAGG - Intergenic
1074401062 10:113141418-113141440 CTTTGGGGGAACGGTGGTGGGGG + Intronic
1074460554 10:113633050-113633072 ATGTGGGGAGACGGTGGAGGGGG - Intronic
1074721086 10:116265848-116265870 CTGTGGGGTGAGGCTAGTGTGGG - Intronic
1075540553 10:123309957-123309979 GTGTGGGGTGTGGGTGGTGGTGG + Intergenic
1075586209 10:123660067-123660089 CTGTGGGGCAACTGTGGTGTAGG + Intergenic
1075744080 10:124714431-124714453 CTGTGTGTTGAGGGTGGTGCTGG - Intronic
1076351147 10:129816056-129816078 CTGTGGGGAGGCAGTGGTGGTGG - Intergenic
1076830025 10:132989434-132989456 TTGTGGGGTGAGAGTGGTGAGGG - Intergenic
1077088094 11:764655-764677 CTGTGTGGTGACTGTGGTATTGG + Intronic
1077174626 11:1183247-1183269 GTGTGTGGTGAAGGTGGTCTGGG - Intronic
1077174842 11:1184366-1184388 GTGTGTGGTGAAGGTGGTCTGGG - Intronic
1077334703 11:1998111-1998133 CTGAGGGGAGACAGTGGTCTGGG - Intergenic
1077469628 11:2751083-2751105 CTGTGGGGTGCGGGGGCTGTGGG - Intronic
1077537974 11:3133586-3133608 CTCTGGGGTGAAGGTGCTGCTGG - Intronic
1078937289 11:15963174-15963196 CTGAGGGGAGACAGTGGTGGGGG + Intergenic
1080217963 11:29867320-29867342 CTGTGGGGTGAGGATGGGTTAGG - Intergenic
1081578416 11:44334342-44334364 TTCTGGGGTGACGGAGGTGTGGG + Intergenic
1083037849 11:59657057-59657079 GTATGGGGGGAGGGTGGTGTTGG - Intronic
1084044462 11:66560709-66560731 CTGCGGGCTGAGGGTGATGTAGG - Exonic
1084089866 11:66872234-66872256 CTGTGGGGCCACTGTGGGGTTGG - Intronic
1084352417 11:68611739-68611761 CTCTGAGGTGACGTTGGAGTGGG + Intronic
1085509047 11:77076513-77076535 CTGAGGGGTGAGGGTGGGGAGGG - Intronic
1087847595 11:102990948-102990970 CTGTGGGGAGAAGATGGTGGAGG + Intergenic
1089466059 11:118687452-118687474 CTCTGGGGTGACAGTGGTCTTGG + Intergenic
1090401411 11:126451909-126451931 CTGTGGGGTGACGCTTCTGGAGG - Intronic
1090545488 11:127761968-127761990 CTTTGGGTTGATGGTGGTTTTGG + Intergenic
1091290371 11:134436114-134436136 CTGGGGAGTGACTGTGGTGAGGG - Intergenic
1202817686 11_KI270721v1_random:53293-53315 CTGAGGGGAGACAGTGGTCTGGG - Intergenic
1092726513 12:11491526-11491548 CTGGGGGGTGTCGGTGGGGAGGG + Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1096829083 12:54300718-54300740 CTGGGGGGTGAAGGAGGTGAGGG - Intronic
1097755162 12:63400088-63400110 CTTTGGGGTGTCTGTGGTGGGGG - Intergenic
1099153616 12:79146499-79146521 CTGTGGTGTGGTGGTGTTGTAGG - Intronic
1102389044 12:112534991-112535013 CCGTGGGGTGAAGGGAGTGTTGG + Intergenic
1102631927 12:114288576-114288598 CTGTGTGGTGGTGGTGGTGGGGG - Intergenic
1102705750 12:114878973-114878995 CTGTGTGGTTAGGGTGGAGTAGG - Intergenic
1103553359 12:121751394-121751416 GTGTGGGGTGAGAGTGGGGTGGG - Intronic
1103606924 12:122093733-122093755 CTGTGTGGTGTGTGTGGTGTGGG + Intronic
1104105444 12:125654556-125654578 CTCTGGGAGGATGGTGGTGTAGG - Exonic
1104648571 12:130514502-130514524 CTGTGGGGGGATGGGGGTGCTGG - Intronic
1104859985 12:131918735-131918757 GTGTGGGGTGTCGGGTGTGTGGG + Intronic
1104860002 12:131918781-131918803 GTGTGGGGTGTCGGGGGTGTGGG + Intronic
1104860016 12:131918834-131918856 GTGTGGGGTGTCGGGTGTGTGGG + Intronic
1104860021 12:131918850-131918872 GTGTGGGGTGTCGGGTGTGTGGG + Intronic
1104860026 12:131918866-131918888 GTGTGGGGTGTCGGGTGTGTGGG + Intronic
1104860061 12:131918974-131918996 GTGTGGGGTGTCGGGTGTGTGGG + Intronic
1104860070 12:131919006-131919028 GTGTGGGGTGTCGGCTGTGTGGG + Intronic
1104907666 12:132222884-132222906 GTGTGGGGTGCGGGTTGTGTGGG - Intronic
1104907676 12:132222918-132222940 GTGTGGGGTGTGGGTTGTGTGGG - Intronic
1104907685 12:132222959-132222981 GTGTGGGGTGCGGGTTGTGTGGG - Intronic
1104907690 12:132222975-132222997 ATGTGGGGTGTGGGTTGTGTGGG - Intronic
1104907752 12:132223229-132223251 ATGTGGGGTGTGGGTTGTGTGGG - Intronic
1104907764 12:132223269-132223291 GTGTGGGGTGTGGGTTGTGTAGG - Intronic
1104907771 12:132223298-132223320 ATGTGGGGTGTGGGTTGTGTGGG - Intronic
1104907784 12:132223338-132223360 GTGTGGGGTGTGGGTTGTGTGGG - Intronic
1104907807 12:132224447-132224469 GTGTGGGGTGCGGGTTGTGTGGG - Intronic
1104907832 12:132224539-132224561 GTGTGGGGTGTGGGTTGTGTGGG - Intronic
1104907837 12:132224555-132224577 GTGTGGGGTGTGGGTTGTGTGGG - Intronic
1105594491 13:21824061-21824083 CTGTGGGTAGATGGTGGTGATGG - Intergenic
1106285408 13:28314184-28314206 CTGTGGGGAGACGATGGTGCAGG - Intronic
1106347571 13:28894116-28894138 TTGTAGGGTGAAGGTGGAGTGGG - Intronic
1107905797 13:45060186-45060208 CTGTGGGTGGATGGTGGTGATGG - Intergenic
1110069656 13:71158267-71158289 CTGTGGATGGATGGTGGTGTTGG + Intergenic
1113034902 13:106037986-106038008 CTGTGGGGGGAGGGTGGGATGGG + Intergenic
1113839449 13:113350521-113350543 CTGTGGGGTGTGTGTGCTGTGGG - Intronic
1113839452 13:113350537-113350559 CTGTGGGGTGTGTGTGCTGTGGG - Intronic
1113839457 13:113350569-113350591 CTGTGGGGTGTGTGTGCTGTGGG - Intronic
1113955976 13:114099906-114099928 CTGTGGGGGGGCTGTGGGGTGGG - Intronic
1114234502 14:20812657-20812679 CTGTGGGGTGGGGGTGGGGTGGG - Intergenic
1115559324 14:34568909-34568931 CTCTGGGGTGGCGCTGGGGTTGG - Intronic
1116159467 14:41250644-41250666 GTGTTGGGTGATGGTGGTGTGGG + Intergenic
1116201682 14:41805548-41805570 CTGTGGGGTGGGGGGGGTGGAGG - Intronic
1116776661 14:49189096-49189118 CTGTGGTGTGAAGGTAGTCTGGG - Intergenic
1118761494 14:68882897-68882919 CTGAGGCGTGATGGTTGTGTAGG + Exonic
1119109410 14:71957557-71957579 CTGTGGGGAGTCGGAGGGGTTGG + Intronic
1119404245 14:74386797-74386819 CTGTAGGGTGATGGTGGCATAGG + Intergenic
1119738976 14:77001527-77001549 CCCTGGGCTGACGGTGGGGTTGG + Intergenic
1120962719 14:90140030-90140052 CTGTGGGGTGACTGTGCAGATGG + Intronic
1120974528 14:90237085-90237107 CTGGGGGGTGGAGGTGGTGGGGG - Intergenic
1121080970 14:91108088-91108110 CTGTGGGGTGCCGGGGGAGAAGG + Intronic
1122791357 14:104185450-104185472 GTGTGGGGTGGGGGTGGAGTGGG + Intergenic
1122905380 14:104799345-104799367 CAGTGGGGTGGGGGTGGTGCTGG - Intergenic
1124478519 15:30058093-30058115 TGATGGGGTGACGGTGGTGCAGG + Intergenic
1124955885 15:34360085-34360107 ATGGGGGGTGGCGGTGGTGGGGG - Intronic
1126100063 15:45113426-45113448 CTGCGGGGTGAGGGTGGGGGTGG + Intronic
1126109597 15:45167595-45167617 CAGTGGGGAGAGGGTGGTGGTGG + Exonic
1126661587 15:51038520-51038542 TTGTGGAGTGAGTGTGGTGTGGG + Intergenic
1126820540 15:52499415-52499437 CTGTGGACAGACGGTGGTGATGG - Intronic
1126849699 15:52789558-52789580 CAGAGGGGTCAAGGTGGTGTAGG + Exonic
1127484537 15:59407144-59407166 CTGTGTGGTGACAGTGGTGCAGG + Intronic
1128204375 15:65837802-65837824 CTGTGTGGTGGTGGTGGTGGGGG - Intronic
1128907793 15:71483744-71483766 CTGTCGGGGGAGGGTGGGGTCGG - Intronic
1129163873 15:73764139-73764161 CTGGGGAGTGAGGGTGGTGGCGG + Intergenic
1129934423 15:79437666-79437688 GTGTGGGGTGTGGGTGGCGTGGG + Intronic
1129934500 15:79437947-79437969 GTGTGGGGTGTGGGTGGGGTGGG + Intronic
1129934685 15:79438590-79438612 GTGTGGGGTGTGGGTGGGGTGGG + Intronic
1129934870 15:79439236-79439258 TTGTGGGGTGTGGGTGGGGTGGG + Intronic
1131271390 15:90949631-90949653 CTGTGGGGAGAAGGCGGTGGTGG - Intronic
1131832063 15:96360517-96360539 CTGTGGGGTGGGGGTGGGGGTGG + Intergenic
1132238966 15:100242906-100242928 CTGTAGGTGGACGGTGGTGATGG - Intronic
1132373138 15:101311671-101311693 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373146 15:101311696-101311718 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373154 15:101311721-101311743 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373162 15:101311746-101311768 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373170 15:101311771-101311793 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373178 15:101311796-101311818 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373195 15:101311846-101311868 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373203 15:101311871-101311893 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373211 15:101311896-101311918 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373233 15:101311973-101311995 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373241 15:101311998-101312020 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373249 15:101312023-101312045 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373257 15:101312048-101312070 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373272 15:101312099-101312121 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373280 15:101312124-101312146 GTGAGGGGTGACGATGGGGTGGG - Intronic
1132373288 15:101312149-101312171 GTGAGGGGTGACGATGGGGTGGG - Intronic
1133501854 16:6373769-6373791 ATGTGGGAAGACGGTTGTGTGGG + Intronic
1133574960 16:7079903-7079925 CTGTGGGTGGATGGTGGTGATGG + Intronic
1133609281 16:7417970-7417992 CTGTGGGATGAGGGTGGTTGTGG - Intronic
1133923941 16:10179702-10179724 CTGTGGGGTGGTGGTGGTGGCGG - Intronic
1134626813 16:15728254-15728276 CTATGTGGTGACTGTGGTGGTGG + Intronic
1138104909 16:54282737-54282759 GTGTGGGGTGACGGTGGAGGCGG - Intergenic
1138584905 16:57963260-57963282 CAGTGGGGAGACAGTGGTTTAGG - Intronic
1138597644 16:58037629-58037651 CTGTGGGGTGTGGATGGTGGGGG - Intronic
1139383374 16:66548598-66548620 CTGGGGGGAGAGGGTGGTGGTGG + Intronic
1139878357 16:70164319-70164341 CTGTGGGATGATGGTGGTCTTGG - Intergenic
1140359205 16:74330497-74330519 CTGTGGGATGATGGTGGTCTTGG + Intergenic
1141547950 16:84784865-84784887 CTGAGGGGTGCCTGTGTTGTTGG + Intergenic
1141617041 16:85215835-85215857 CGGTGGGGTTACGGTGGGGACGG - Intergenic
1141672213 16:85498041-85498063 CAGTGGGGTGGGGGTGGGGTGGG + Intergenic
1141932481 16:87215355-87215377 CTGTGGGTTGACGATGGAGACGG + Intronic
1142216784 16:88834004-88834026 GGGTGGGGGGAGGGTGGTGTTGG - Intronic
1143474856 17:7196713-7196735 CTGTGGGGAGGGGGTGGTGCAGG + Intronic
1143585553 17:7848662-7848684 CTGGGGGGTGGGGGTGGTGGTGG - Exonic
1143617968 17:8064703-8064725 CCGTGGGGGGAAGGTGGAGTGGG + Intergenic
1143703948 17:8683600-8683622 GTGTGTGGTGATGGTGGTGGGGG - Intergenic
1144962495 17:19053048-19053070 CTCTGGGATGACAGTGGTTTTGG - Intergenic
1144972666 17:19121472-19121494 CTCTGGGATGACAGTGGTTTTGG + Intergenic
1146161819 17:30564158-30564180 CTTTGGGGTGGCGGTGGCGGTGG - Intergenic
1147458707 17:40554742-40554764 CTATGGGGAGAAGGTGGTGGTGG + Exonic
1148551290 17:48552091-48552113 CTGTTTGGTGAGGGTGGAGTTGG + Exonic
1148686257 17:49502757-49502779 CTGTGGGGTGACAGAGGGGAGGG + Intronic
1148687938 17:49510956-49510978 CTGTGGGGTGAAGGAGGTTGGGG - Intronic
1151534141 17:74729262-74729284 CTGGTGGGTGACAGTGGTGTGGG + Intronic
1152088151 17:78232460-78232482 CTGTGGGGCGACAGTGGGGGAGG + Intronic
1152263434 17:79279443-79279465 CTGTGCCGTGAGGGTGGTGGGGG - Intronic
1153476565 18:5505001-5505023 CTGCTGAGTGAAGGTGGTGTTGG - Intronic
1153495039 18:5689302-5689324 CTGTGGGGTGGGGGTGGGGGAGG - Intergenic
1153753485 18:8257305-8257327 CTGTGGGATGAGGGTGGTCAGGG + Intronic
1153945934 18:10017474-10017496 CTGTGGGGAGAGGCTGGTGCTGG + Intergenic
1154041535 18:10860520-10860542 TTGTGTGTTGACGATGGTGTGGG - Intronic
1154485077 18:14866672-14866694 TTGTGGGGTGGTGGTGGGGTGGG + Intergenic
1156164552 18:34402716-34402738 CTCTGTGGTGGCGGTGGGGTTGG - Intergenic
1157386440 18:47262669-47262691 GGGTGGGGTGGCGGTGGTGTGGG + Intergenic
1157499669 18:48180586-48180608 CTGTAGGGTGATGGGGGGGTGGG + Intronic
1158453554 18:57587358-57587380 GGGTGGGCTGACGGAGGTGTAGG - Intergenic
1160394915 18:78564066-78564088 ATGTGGGGTGTGGGGGGTGTGGG - Intergenic
1160753573 19:746842-746864 CTGGTGGGTGTCTGTGGTGTGGG - Exonic
1160823386 19:1068300-1068322 CTGTGGGGTCAGGGTGATGGTGG + Intronic
1160823573 19:1069065-1069087 GTGTGGGGTGCCGCTGGTGTAGG + Intronic
1160989283 19:1853976-1853998 CGGTGGGGTGGGGGTGGGGTGGG + Exonic
1161850265 19:6734306-6734328 CCCTGGGGTGAGGGTGGGGTGGG + Exonic
1161885036 19:6988026-6988048 CTGTGGGTGGATGGTGGTGATGG + Intergenic
1162320859 19:9970039-9970061 CTGTGGGGTGAATGAGGTCTGGG + Intronic
1162463126 19:10825013-10825035 CTGAGGGGTGACTGTGGCCTGGG - Intronic
1162806233 19:13139282-13139304 CTGTGGGGTGGGGTGGGTGTGGG - Exonic
1164258452 19:23549440-23549462 CTGTGGGCTGCCCGTGGAGTTGG - Intronic
1164591146 19:29507645-29507667 CTGTGGGGTGACCCTGGAGCAGG - Intergenic
1164863649 19:31584103-31584125 GTGTGTGGTGTCTGTGGTGTTGG + Intergenic
1164962555 19:32446839-32446861 CTGTCGGTTGAAGGTGTTGTTGG - Intronic
1165829688 19:38724293-38724315 TTGCGGGGTGACGGTGGTGTAGG - Exonic
1166271443 19:41716832-41716854 CTGTGGGTAGATGGTGGTGATGG - Intronic
1166399573 19:42468375-42468397 CTGTGGGGGGAATGTGGTGGAGG + Intergenic
1166881482 19:45933107-45933129 GTGTGTGGTGGTGGTGGTGTCGG + Intergenic
1166881973 19:45935233-45935255 CTGTGGGGTCATGGTGGTGAAGG - Exonic
925541673 2:4974201-4974223 GTGTGTGGTGTGGGTGGTGTGGG + Intergenic
925914784 2:8597029-8597051 GTGTGGGGTGTGTGTGGTGTGGG + Intergenic
926193509 2:10745698-10745720 CTGTGGGTGGAGGGTGGTGACGG - Intronic
926892509 2:17650290-17650312 CTTTGGTGTGAGGGTGGAGTGGG - Intronic
926902122 2:17763586-17763608 ATGTGGGGTGGAGGTGGTATTGG - Intronic
927929028 2:27032423-27032445 CTGAGGGGTGGGGGTGGGGTGGG + Intergenic
928112072 2:28518749-28518771 CTGTGGGTGGATGGTGTTGTGGG + Intronic
931980617 2:67690070-67690092 GTGTGGGGTGGGGGTGGTGTGGG + Intergenic
932012488 2:67992478-67992500 CAATGGGCTGATGGTGGTGTTGG - Intergenic
932841651 2:75088713-75088735 GTGTGGGGTGATGGGGGTTTAGG + Intronic
932873409 2:75426155-75426177 CTTTGGGGTGAGGGAGGTGAAGG - Intergenic
935594590 2:104868927-104868949 CAGTGGGGTGAGGGTGGGGCAGG + Intergenic
937967487 2:127525131-127525153 ATGGGGGGTGGGGGTGGTGTTGG + Intronic
938081647 2:128373444-128373466 GTGTGGGGTGGGGGTGGGGTGGG - Intergenic
940292318 2:152089469-152089491 CAGTGGGGTGAGCCTGGTGTAGG - Intronic
940745014 2:157557377-157557399 CAGTTGGGAGACCGTGGTGTTGG + Intronic
942460234 2:176163360-176163382 CTGAGCGGTGACAGTGGTGGGGG + Intronic
943363374 2:186946997-186947019 CTGTGGAGTGATGTGGGTGTTGG - Intergenic
946280177 2:218660811-218660833 TTGTGGGGTAAGGGTGGTATTGG - Intronic
947916092 2:233832744-233832766 CTGTGGGGTTTCGGGGGGGTGGG + Intronic
1169757826 20:9062340-9062362 CTGTGGTGTGGTGGTGGTGGTGG + Intergenic
1170478098 20:16736708-16736730 CTGTGGGGTGAGGGTAGGTTTGG + Intronic
1172021902 20:31920516-31920538 CTGAGCGGTGACGATGGTGCAGG + Intronic
1172287775 20:33753268-33753290 CTCTGGGGTGGAGGTGGTGGAGG - Exonic
1173465767 20:43280020-43280042 GTGTGTGGTGGTGGTGGTGTCGG + Intergenic
1174349294 20:49955570-49955592 CTGTGTGGTGATGGTGGTGGTGG + Intergenic
1174361236 20:50030055-50030077 GCGTGGGGTGAGGGTGGTGCTGG - Intergenic
1175278170 20:57786023-57786045 GTGTGGGGCGGCGGTGGTGGGGG + Intergenic
1175575325 20:60056568-60056590 CTGTGGGGTGACAGAGCTGTGGG + Intronic
1175710471 20:61216567-61216589 CTTTGAGGTGATGGTGGAGTAGG - Intergenic
1176019962 20:62957488-62957510 CAGTGGGGTGACGGCCGTGATGG - Exonic
1176517394 21:7796260-7796282 CTGTGAGGTGAAGGTGGTGAAGG + Intergenic
1178651422 21:34426272-34426294 CTGTGAGGTGAAGGTGGTGAAGG + Intergenic
1179532134 21:42027015-42027037 GTGTGGGGTGTGTGTGGTGTAGG + Intergenic
1179892717 21:44345070-44345092 CTATGGGGCGAAGGTGGTGGAGG - Intergenic
1180102130 21:45593295-45593317 CCGTGGGGCGACGGGGCTGTGGG - Intergenic
1180184324 21:46131931-46131953 CTGTGGGGAGACGCAGGTGCGGG - Intronic
1180796916 22:18610410-18610432 CTGTGGGCTGACGGTGGTGGTGG + Exonic
1181167614 22:20991994-20992016 CTGTGGGGTGAAGCTGGGGCTGG - Intronic
1181224808 22:21384861-21384883 CTGTGGGCTGACGGTGGTGGTGG - Exonic
1181253824 22:21549952-21549974 CTGTGGGCTGACGGTGGTGGTGG + Exonic
1183038931 22:35161686-35161708 CTGTGGGGCGAGGGTGGGCTGGG + Intergenic
1184411078 22:44326924-44326946 CTTTGGGGAGTCGGGGGTGTGGG - Intergenic
1184696719 22:46143559-46143581 CTGCAAGGTGACGGTGGCGTGGG - Intergenic
1185367997 22:50445745-50445767 CTGTGGGGTGGGGGAGGTGGCGG + Exonic
949921070 3:9000916-9000938 CTGTGGGATGACAGTGGTTTTGG - Intronic
950033433 3:9867008-9867030 CTGCGCGGTGAGGGAGGTGTGGG + Exonic
950055076 3:10017788-10017810 CTGTGTGGTGAGGGAGGTGTCGG + Intergenic
950853304 3:16083095-16083117 CTGTGTGATGAAGGTGGTGATGG + Intergenic
952130117 3:30352285-30352307 CTGTGGGCTGAAGGTGGTTCAGG - Intergenic
952492475 3:33885612-33885634 TTCTGGGGTAATGGTGGTGTTGG + Intergenic
952766503 3:36958683-36958705 CTGTGAGGAGACAGTTGTGTAGG + Intergenic
953472473 3:43178926-43178948 GTACGGGGTGACGGTGGTGGTGG - Intergenic
954590451 3:51777900-51777922 CTGTGGGGGGATGGTTGTGGGGG - Intergenic
954594602 3:51813991-51814013 CTGTGGGGGGATGGTGGTGGGGG + Intergenic
958104458 3:89054330-89054352 CTGTGTGTTGACAGTGGTGGGGG + Intergenic
959169378 3:102826032-102826054 TTGTGGGGTGGCGGGGGGGTGGG + Intergenic
960759550 3:121058123-121058145 CTGTTGGGTGATGGGGGTGTAGG - Intronic
961388752 3:126539495-126539517 GTGTGGGGTGTGTGTGGTGTGGG - Intronic
961388765 3:126539581-126539603 GTGTGGGGTGTGTGTGGTGTGGG - Intronic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
965435874 3:168650672-168650694 CTGTGGGGTCACAGTGTTGTGGG + Intergenic
966835454 3:184046146-184046168 CTGTGGTGTGGCTGGGGTGTGGG - Intergenic
967117576 3:186355573-186355595 TGGTGGGGTGATGGTGGTGGGGG - Intronic
968875412 4:3264571-3264593 CTGTGGAGGGATGGTGGTGATGG - Intronic
969248218 4:5949607-5949629 CTGTGGGTGGATGGTGGTGATGG + Intronic
969411002 4:7028106-7028128 GTGTGGGGTGACGTGTGTGTGGG - Intronic
969439913 4:7210923-7210945 CTGTGGGGTCACTGAGGTATTGG - Intronic
971149660 4:24018477-24018499 ATGTGGGGTGAGGGTGATGAGGG + Intergenic
971216234 4:24664818-24664840 CTGTAGGATGACTGTGGTATGGG + Intergenic
972784999 4:42318533-42318555 CAGAGGGGTGGCGGTGGTGGGGG - Intergenic
976002487 4:80388142-80388164 CTGTGGGGTGGAGGTGGTGAGGG + Intronic
979099586 4:116598714-116598736 CTGTGGGGTGACGGTGGTGTAGG - Intergenic
980071974 4:128253213-128253235 TTGTTGGGTGATGGTGGTGGTGG - Intergenic
980483591 4:133423662-133423684 CTGTGTGGTGATGGTGGAGGTGG + Intergenic
984869935 4:184316937-184316959 CGGTGGGGAGAAGGTGTTGTAGG - Intergenic
985413592 4:189712925-189712947 CTATAGGGTGACGGTGGTTGAGG + Intergenic
985614136 5:909457-909479 CTGTGGTGAGACAGTGGTGATGG - Intronic
985732218 5:1555745-1555767 CTGTGGGGTGGCTGTGGAGCGGG + Intergenic
988613481 5:32750621-32750643 TTGTGGGGTGGAGGTGGGGTGGG + Intronic
989145596 5:38246360-38246382 CTGTGGGGTGAGGGAAGTGTGGG + Intergenic
990065508 5:51709612-51709634 CTGTGGGGAGGTGGTGGTGCTGG - Intergenic
990373243 5:55142456-55142478 CTGTGGGCTCATGATGGTGTTGG - Intronic
991071732 5:62490592-62490614 CTCTGGGGAGACGGTAGAGTAGG + Intronic
995146859 5:108796646-108796668 CTGTGGGCCTACGGTGGTGGTGG - Intronic
996579938 5:125020143-125020165 CCGTGTGCTGAAGGTGGTGTTGG + Intergenic
996804752 5:127441812-127441834 CTGTGAGGTGCCAGTGGAGTGGG - Intronic
997871126 5:137505910-137505932 CTGTGGTTTGAAGGTGATGTTGG + Intronic
997932415 5:138083506-138083528 CTGTGAGGTGATGGAGCTGTGGG - Intergenic
1000507237 5:162136469-162136491 GTGTGGGGTGGTGGTGGTGGTGG + Intronic
1001289967 5:170450116-170450138 GGGTGGGGTGAGGGTGGGGTGGG - Intronic
1001396427 5:171421866-171421888 CTGTGTGGTGATGGGGGTGGGGG + Intronic
1001411128 5:171512789-171512811 TTTTGGGGTGAGGGTGGTGGAGG - Intergenic
1001696484 5:173674050-173674072 CTTTGGGGTGACGGTTGGGAAGG + Intergenic
1001731623 5:173964530-173964552 GGGTGGGGTGAGGGTGGGGTGGG + Intergenic
1001731631 5:173964546-173964568 GGGTGGGGTGAGGGTGGGGTGGG + Intergenic
1001731660 5:173964606-173964628 GGGTGGGGTGAGGGTGGGGTGGG + Intergenic
1002051764 5:176575440-176575462 CTGTGGGGTGTGGGTGGAGGCGG + Intronic
1002775958 6:327634-327656 CTGTGTGCTGCTGGTGGTGTGGG + Intronic
1004576055 6:16896269-16896291 CTCTGGGATGACAGTGGTTTTGG + Intergenic
1004749141 6:18543022-18543044 TTCTGGGAAGACGGTGGTGTAGG + Intergenic
1005802405 6:29440462-29440484 CTGTGGGGTGCTGGTGGGGCTGG + Exonic
1005866090 6:29938331-29938353 CTGTTGGGGGAGGGTGGTGATGG + Intergenic
1006161826 6:32043797-32043819 CTATGAGGTGACCGTGGTCTCGG - Exonic
1006715922 6:36120513-36120535 GTGGGGGGTGGCGGTGGTGGTGG - Intergenic
1007409408 6:41653296-41653318 CTGCGGGGTGGCGGTGGAGAGGG - Intronic
1007479696 6:42142104-42142126 CTGTGCGGTGAGAGAGGTGTGGG - Intronic
1007696702 6:43738570-43738592 CTGTGGTGTGTGTGTGGTGTCGG + Intergenic
1007752205 6:44077282-44077304 CTGTGGGGTGAGGGGTGTGGGGG - Intergenic
1009818165 6:68763783-68763805 CGGTGCGGTGGCGGTGGTGGTGG + Intronic
1010837698 6:80610679-80610701 GTGTAGGGTGATGGTGGTGGTGG + Intergenic
1011297699 6:85841223-85841245 CTGTGGGGTGGGGGTGGGGGGGG + Intergenic
1012062348 6:94504801-94504823 GTGTGGGGGGAGGGTGGGGTTGG - Intergenic
1013198526 6:107867482-107867504 CTGTGGAGTGCAGGTGGTGCAGG - Intergenic
1013612587 6:111808723-111808745 CTGTGTGATGATGGTGGTGAGGG - Intronic
1014210538 6:118703741-118703763 CTTTTGGGTGAGGGTTGTGTGGG + Intronic
1014317387 6:119884567-119884589 CTGTGGGGTGAGGATAGTGATGG - Intergenic
1015591036 6:134823259-134823281 CTGTGGGGTGAGGAGGTTGTAGG - Intergenic
1018438642 6:163787884-163787906 CTGTGGGGTGGGGGTGGTCTAGG + Intergenic
1019134791 6:169901317-169901339 TGATGGGGTGACGGTGATGTTGG + Intergenic
1019134798 6:169901351-169901373 TGATGGGGTGACGGTGATGTTGG + Intergenic
1019152837 6:170020249-170020271 CTGTGGGATGGCGGTGCTGCTGG - Intergenic
1019263152 7:93633-93655 CTGTGGGATGAGGGTGGGGTTGG - Intergenic
1019507573 7:1400315-1400337 CTGGGGGGTGAGGGTTGAGTGGG - Intergenic
1019627122 7:2022179-2022201 GTGTGGGGTGACGATGGTGCAGG + Intronic
1020040136 7:4995647-4995669 CTGTGGGGTAATGGAGGAGTAGG + Intronic
1020363652 7:7356690-7356712 TTGTGGGGTGGCGGGGGAGTGGG + Intronic
1021172342 7:17413969-17413991 ATGTGGAGTGACTGGGGTGTTGG + Intergenic
1021378318 7:19935815-19935837 CTCTGGGATGACAGTGGTTTTGG - Intergenic
1022528793 7:31054194-31054216 GTGTGGGGTGACGATGGAGGCGG + Intronic
1024979811 7:55147701-55147723 CTGTGTGTGGACGGTGGTGATGG - Intronic
1024980839 7:55156310-55156332 CTTTGGGGCTACGGCGGTGTAGG - Intronic
1026115470 7:67492060-67492082 CTGTGGGCTCCTGGTGGTGTGGG + Intergenic
1027144969 7:75688184-75688206 CGGAGGGGTGTTGGTGGTGTGGG - Intronic
1027150743 7:75731790-75731812 CCGTGGGGTGCCAGGGGTGTGGG + Intronic
1027655892 7:80930434-80930456 GTGTGGGGGGAGGGTGGTGGGGG - Intergenic
1029459690 7:100687661-100687683 CTGTGGGGTGGGGGTGGAGGTGG - Intronic
1029858290 7:103541076-103541098 GTGTGGGGTGGTGGTGGTGGTGG + Intronic
1031032633 7:116751416-116751438 CTGTCGGGTGGCGGGGGTCTAGG + Intronic
1032876167 7:136040768-136040790 GTGTGGGGGGGCGGTGGGGTGGG + Intergenic
1033281642 7:140010074-140010096 GTGTGGGGTGGGTGTGGTGTGGG - Intronic
1033390661 7:140924672-140924694 CTGAGCGGTGGCGGTGGTGGCGG - Exonic
1033601085 7:142888824-142888846 TTTTGGGGTGAAGGTGGTGAGGG + Intergenic
1035294717 7:157860344-157860366 CTGTGGGTGGACTGTGGGGTGGG - Intronic
1035923234 8:3700980-3701002 GTGAGGGGCGACGGTGGTTTGGG + Intronic
1036776772 8:11618031-11618053 GTGTAGGGGGAGGGTGGTGTCGG + Intergenic
1036784523 8:11677168-11677190 CTGTGGGGAGAGGGAGGTGGGGG + Intronic
1037319243 8:17628566-17628588 TTGTCGGGTGACCGTGCTGTCGG + Exonic
1039768496 8:40658446-40658468 GTGTGTGGTAGCGGTGGTGTGGG + Intronic
1039835305 8:41251350-41251372 CTGTGGAGGGACGGTGGTAATGG - Intergenic
1040555776 8:48476403-48476425 CAGTGGGGAAACTGTGGTGTGGG - Intergenic
1041147596 8:54893969-54893991 CTGTGGGGTCACCGTGGTTGAGG + Intergenic
1043468107 8:80534324-80534346 CTGTGGAGTGGAGGTGGTGAGGG + Intergenic
1044591204 8:93916473-93916495 CTGCGGGGATGCGGTGGTGTGGG - Intronic
1045662542 8:104453032-104453054 CTGTTGGGGGAGGGTGGTGGGGG - Intronic
1045951453 8:107856001-107856023 CTATGGGATGACGGAGCTGTGGG - Intergenic
1046572313 8:115981624-115981646 CTGTCGGGTGATGGGGGTGGGGG + Intergenic
1047336597 8:123942257-123942279 CTGTGGGCTGGCAATGGTGTAGG - Intronic
1047594707 8:126366511-126366533 AGGTGGGGTGACGGGGGTGGCGG - Intergenic
1049786925 8:144455534-144455556 CTGTGAGAGGACAGTGGTGTGGG - Intronic
1052015811 9:23464476-23464498 CTCTGTGGTGACAGTGGTTTTGG - Intergenic
1052975306 9:34405832-34405854 CTGGGGGGTGAGGGAGATGTGGG - Intronic
1053429413 9:38032337-38032359 CTTTGGGGTGACGCTGGCCTGGG - Intronic
1054839028 9:69715483-69715505 AGGCGGGGTGAAGGTGGTGTTGG + Intronic
1055579916 9:77697993-77698015 CTGTGGGCCTACGGTGGTGGTGG - Intergenic
1055711751 9:79070668-79070690 CTGTGGGTGGATGGTGGTGATGG + Intergenic
1056507542 9:87271360-87271382 TTTTGGGGTGGGGGTGGTGTTGG - Intergenic
1057806004 9:98220434-98220456 CTGTGGGGGGAGGGTCGTGCTGG + Intronic
1058628413 9:106959887-106959909 CTGTGGGGTGAGTTTGGAGTGGG + Intronic
1059429935 9:114243824-114243846 ATGTGGGGTGGGGGTGGTGGAGG + Intronic
1059900556 9:118921036-118921058 CTGTGGGCTGGTGGTGGTGGTGG - Intergenic
1060066254 9:120503845-120503867 TTGTGGGGTGGTGGTGGTGGTGG - Intronic
1060626580 9:125118696-125118718 ATGTGGGGTGGGGGTGGTGAGGG - Intronic
1060834085 9:126741906-126741928 ATGCGGGGTGGGGGTGGTGTAGG + Intergenic
1061500533 9:130998917-130998939 CTGTGGGGTGAGGCTGGAGCAGG - Intergenic
1062003755 9:134229293-134229315 CTGTGGGAGGAAGATGGTGTGGG + Intergenic
1062334045 9:136057118-136057140 TTGTGGGGTGCCCGTGGCGTTGG + Intronic
1062627405 9:137449540-137449562 CTGCGGGGCCACGGTGGGGTGGG - Intronic
1062703599 9:137921526-137921548 CTGTGCGGTCACGGTGCTGATGG - Intronic
1203639370 Un_KI270750v1:145464-145486 CTATAGGGTGACGGTGGTTGAGG - Intergenic
1185645253 X:1611024-1611046 TTTTGGGGTGAAGGTGGTTTTGG - Intergenic
1187035219 X:15531557-15531579 CAGTGGGGTGAGAGTGGTGGAGG - Intronic
1190524035 X:51310669-51310691 CAGTGTGCTGAAGGTGGTGTTGG + Intergenic
1192304866 X:69948503-69948525 CAGTGGGGTGGGGGTGGTGGTGG - Intronic
1193082940 X:77423412-77423434 CTGTGGGGTGGGGGTGGGGGTGG + Intergenic
1193563948 X:83054537-83054559 CTGTAGTCTGAGGGTGGTGTTGG + Intergenic
1195333398 X:103825729-103825751 CTCTTGGGTGATGGTGGAGTTGG - Exonic
1196590689 X:117483137-117483159 CAGTGGGGGAAGGGTGGTGTTGG - Intergenic
1199700452 X:150371645-150371667 TTGTGGGGTGAGGGTGGAGCTGG - Intronic
1201758621 Y:17515574-17515596 CTGTGTGATGAGGGTGGGGTGGG + Intergenic
1201842934 Y:18390416-18390438 CTGTGTGATGAGGGTGGGGTGGG - Intergenic