ID: 979099738

View in Genome Browser
Species Human (GRCh38)
Location 4:116599516-116599538
Sequence GCCCGCATGGTGCCCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979099734_979099738 -4 Left 979099734 4:116599497-116599519 CCAGGCCGAGTACTCTATTGCCC 0: 1
1: 0
2: 0
3: 5
4: 47
Right 979099738 4:116599516-116599538 GCCCGCATGGTGCCCTACCAGGG 0: 1
1: 0
2: 2
3: 8
4: 58
979099733_979099738 0 Left 979099733 4:116599493-116599515 CCGACCAGGCCGAGTACTCTATT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 979099738 4:116599516-116599538 GCCCGCATGGTGCCCTACCAGGG 0: 1
1: 0
2: 2
3: 8
4: 58
979099731_979099738 2 Left 979099731 4:116599491-116599513 CCCCGACCAGGCCGAGTACTCTA 0: 1
1: 0
2: 1
3: 1
4: 17
Right 979099738 4:116599516-116599538 GCCCGCATGGTGCCCTACCAGGG 0: 1
1: 0
2: 2
3: 8
4: 58
979099735_979099738 -9 Left 979099735 4:116599502-116599524 CCGAGTACTCTATTGCCCGCATG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 979099738 4:116599516-116599538 GCCCGCATGGTGCCCTACCAGGG 0: 1
1: 0
2: 2
3: 8
4: 58
979099732_979099738 1 Left 979099732 4:116599492-116599514 CCCGACCAGGCCGAGTACTCTAT 0: 1
1: 0
2: 1
3: 3
4: 62
Right 979099738 4:116599516-116599538 GCCCGCATGGTGCCCTACCAGGG 0: 1
1: 0
2: 2
3: 8
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979099738 Original CRISPR GCCCGCATGGTGCCCTACCA GGG Intergenic
900385758 1:2409894-2409916 GCCAGCCTGGTTCCCTACGAGGG - Intronic
900646825 1:3712872-3712894 GCCCGTGTGGTGCCCCACCCCGG + Intronic
902671950 1:17980648-17980670 GTCCTCATGGTGCCTTACCTAGG + Intergenic
903173942 1:21569737-21569759 GCCCACATGGTGCCCTCTCCAGG + Intronic
911184393 1:94888693-94888715 GCAAGCATGGTGCCCTATCAGGG + Intronic
918107182 1:181425255-181425277 GCGCTCATCGTGCCCTGCCAAGG - Intronic
924775459 1:247112298-247112320 GCCCGCCTGGAGCCCGAGCATGG - Exonic
1063377810 10:5564453-5564475 GCCCGGCTGGTGCCCTTCCACGG + Intergenic
1067565104 10:47330892-47330914 GGGCGAATGCTGCCCTACCAGGG + Intergenic
1071598644 10:86945352-86945374 GGCCGCAGGGAGCCCTACCGTGG + Exonic
1077445916 11:2590775-2590797 GGCCACATGGAGCCCTCCCATGG - Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1084096636 11:66915659-66915681 GCCCGCAGGGGGAGCTACCAGGG + Intronic
1084973135 11:72781960-72781982 GCGCGCAGGGTCCCCTCCCAGGG - Intronic
1087477342 11:98652647-98652669 GCAAGCATTGTGTCCTACCATGG - Intergenic
1089065465 11:115659214-115659236 TCCCGCAGGGTCCCCTCCCACGG - Intergenic
1091360298 11:134974013-134974035 TCCCGCATGCTGCTGTACCATGG - Intergenic
1100026442 12:90134382-90134404 GTCCCCATGGAGCCCTACCCCGG - Intergenic
1101441841 12:104709663-104709685 GACCGCAGGGTGCCCTGCGACGG - Intronic
1103898900 12:124293287-124293309 GCCCGCATCCTGCCCTGCCCTGG + Intronic
1104860312 12:131920008-131920030 GCCAGCGTGGTGTCCTGCCAGGG + Exonic
1104971805 12:132534153-132534175 GCCCCCATGCTGACCTCCCAGGG - Intronic
1105943339 13:25170361-25170383 CCCGGCGTGGTGGCCTACCAAGG - Exonic
1113908594 13:113831467-113831489 ACACGCAGGGTGCCCCACCAGGG - Intronic
1121121157 14:91376709-91376731 CCCTGGATGGTGCCCTCCCATGG + Intronic
1121715632 14:96071806-96071828 GCACACAGGGTGCCCTGCCAGGG + Intronic
1122968603 14:105143440-105143462 GCCTGCCTGGTGCCTTCCCAGGG + Intronic
1126158804 15:45589608-45589630 GCTCGTATTGTGCCCTTCCAGGG + Intronic
1126849589 15:52789148-52789170 GCCGGCATGGTGCCCATCAACGG - Exonic
1129276326 15:74448103-74448125 GCCTGCCTGGTGCCCCTCCATGG + Intronic
1129744753 15:78010302-78010324 TCCCGCTTGGAGCCATACCAGGG - Intronic
1131036609 15:89226615-89226637 GCCCTCATGGTTCCTTCCCACGG - Intergenic
1132244153 15:100281272-100281294 GCCGACATGGTGCAGTACCACGG - Exonic
1132346807 15:101113552-101113574 GGCAGCATGATGCCCTCCCAGGG + Intergenic
1134054268 16:11159477-11159499 GCTGGCATGGTGCCTTACCAAGG - Intronic
1136071180 16:27788237-27788259 GCCCGCATGGTCCCCTCCCCAGG + Exonic
1137974918 16:53023200-53023222 GCCCTCATGGAGACCTAGCAGGG + Intergenic
1138346539 16:56323827-56323849 GCCTCCATGGTTCCCTCCCATGG - Intronic
1143563272 17:7707548-7707570 GCCCGCATGGTTGGCTGCCATGG + Intronic
1144785867 17:17831279-17831301 GCCCCCATTGTGCCCTACCAGGG + Intronic
1148567470 17:48642151-48642173 CCCGGCATGGCGCCCCACCACGG + Intergenic
1154494834 18:14947997-14948019 TCCCGCATGCTGCTGTACCACGG + Intergenic
1157347914 18:46856815-46856837 GCCCCCATGGTGCTCTAACTGGG + Intronic
1163104490 19:15115636-15115658 GCCAGCATCATTCCCTACCAAGG + Exonic
1165811980 19:38617366-38617388 GCCAACATCGTGGCCTACCATGG - Exonic
1165830801 19:38729337-38729359 GCCCGCATGGCGCCATACCAGGG + Exonic
1165921514 19:39301180-39301202 GGCAGCATGGTGCCCTGCCCAGG + Intergenic
925449511 2:3956810-3956832 GCCCTCATGGTGCCCTCCTCAGG - Intergenic
925614829 2:5735155-5735177 GCCCTCACAGTGCCCTGCCACGG + Intergenic
938763290 2:134443993-134444015 GCTAGCATGGGGCCCTACAAAGG + Intronic
1168891759 20:1299581-1299603 ACTGACATGGTGCCCTACCAGGG - Intronic
1175732751 20:61365170-61365192 GCCCCCATGATGACCTACCTTGG - Intronic
1177631569 21:23735368-23735390 GTCTGCTTAGTGCCCTACCAGGG - Intergenic
1180857588 22:19058200-19058222 GGACACATGGTGCCCTGCCATGG + Intronic
1182457509 22:30461339-30461361 GCCCACATGGTGCCCGAGGATGG - Exonic
958864365 3:99483929-99483951 GCCTGCAAGGTTTCCTACCAAGG + Intergenic
961137809 3:124528182-124528204 GCCTGCATGGAGACCCACCATGG + Intronic
967973457 3:195016142-195016164 CCCTCCATGGTGCCCTACCCAGG + Intergenic
974105537 4:57465950-57465972 GCACACATGGTACCCTACCTCGG - Intergenic
979099738 4:116599516-116599538 GCCCGCATGGTGCCCTACCAGGG + Intergenic
1017992657 6:159504809-159504831 GCCAGCCTGATGCCCTGCCAAGG + Intergenic
1019502507 7:1371398-1371420 GCCTGCATGGTGCCCGACCCAGG - Intergenic
1022725767 7:32980199-32980221 GCCCCCATGGTGTCCAACCATGG - Intronic
1025047845 7:55707498-55707520 GCCCCCATGGTGTCCAACCATGG + Intergenic
1026866130 7:73825138-73825160 GCCCACGTGGTGCCCAACCTGGG + Intronic
1029184921 7:98731561-98731583 CCCCGCTTCGGGCCCTACCAGGG - Intergenic
1049847551 8:144810423-144810445 CCCATCTTGGTGCCCTACCAGGG - Intronic
1062566734 9:137167015-137167037 ACCCTCATGGTGCCCTCCCAGGG + Intronic
1191715694 X:64192187-64192209 TCCTGCCTGGTGACCTACCAAGG - Exonic