ID: 979099815

View in Genome Browser
Species Human (GRCh38)
Location 4:116599794-116599816
Sequence GGAGGTTCCCCCGACCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979099810_979099815 2 Left 979099810 4:116599769-116599791 CCTGTCTCTTTTTGGGAGTTGGC No data
Right 979099815 4:116599794-116599816 GGAGGTTCCCCCGACCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979099815 Original CRISPR GGAGGTTCCCCCGACCAGGT TGG Intergenic
No off target data available for this crispr