ID: 979100220

View in Genome Browser
Species Human (GRCh38)
Location 4:116603679-116603701
Sequence TGTGCTGGTACTCACCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979100215_979100220 24 Left 979100215 4:116603632-116603654 CCTTTAAGGCCCAAGGTCTCTTC No data
Right 979100220 4:116603679-116603701 TGTGCTGGTACTCACCATTCAGG No data
979100216_979100220 15 Left 979100216 4:116603641-116603663 CCCAAGGTCTCTTCAGTCAATTT No data
Right 979100220 4:116603679-116603701 TGTGCTGGTACTCACCATTCAGG No data
979100217_979100220 14 Left 979100217 4:116603642-116603664 CCAAGGTCTCTTCAGTCAATTTG No data
Right 979100220 4:116603679-116603701 TGTGCTGGTACTCACCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979100220 Original CRISPR TGTGCTGGTACTCACCATTC AGG Intergenic
No off target data available for this crispr