ID: 979107437

View in Genome Browser
Species Human (GRCh38)
Location 4:116705674-116705696
Sequence CCTTCCTTGCAGAGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979107437_979107447 20 Left 979107437 4:116705674-116705696 CCCTGCAGCCTCTGCAAGGAAGG No data
Right 979107447 4:116705717-116705739 CAGACTCCTGCTGCGTCCACTGG No data
979107437_979107441 -9 Left 979107437 4:116705674-116705696 CCCTGCAGCCTCTGCAAGGAAGG No data
Right 979107441 4:116705688-116705710 CAAGGAAGGCACCGCCCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979107437 Original CRISPR CCTTCCTTGCAGAGGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr