ID: 979111783

View in Genome Browser
Species Human (GRCh38)
Location 4:116767097-116767119
Sequence GATCCTTTTTTTTTTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979111783_979111784 -6 Left 979111783 4:116767097-116767119 CCAAAAAAAAAAAAAAAAGGATC No data
Right 979111784 4:116767114-116767136 AGGATCGACAAAGTGTGAGCAGG No data
979111783_979111786 -4 Left 979111783 4:116767097-116767119 CCAAAAAAAAAAAAAAAAGGATC No data
Right 979111786 4:116767116-116767138 GATCGACAAAGTGTGAGCAGGGG No data
979111783_979111785 -5 Left 979111783 4:116767097-116767119 CCAAAAAAAAAAAAAAAAGGATC No data
Right 979111785 4:116767115-116767137 GGATCGACAAAGTGTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979111783 Original CRISPR GATCCTTTTTTTTTTTTTTT TGG (reversed) Intergenic
No off target data available for this crispr