ID: 979111785

View in Genome Browser
Species Human (GRCh38)
Location 4:116767115-116767137
Sequence GGATCGACAAAGTGTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979111783_979111785 -5 Left 979111783 4:116767097-116767119 CCAAAAAAAAAAAAAAAAGGATC No data
Right 979111785 4:116767115-116767137 GGATCGACAAAGTGTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979111785 Original CRISPR GGATCGACAAAGTGTGAGCA GGG Intergenic
No off target data available for this crispr