ID: 979112027

View in Genome Browser
Species Human (GRCh38)
Location 4:116770831-116770853
Sequence CTCTATTAGCAGAACGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979112027_979112031 1 Left 979112027 4:116770831-116770853 CCCTCCTCGTTCTGCTAATAGAG No data
Right 979112031 4:116770855-116770877 CCGTAGATGACACAAACAAACGG No data
979112027_979112032 22 Left 979112027 4:116770831-116770853 CCCTCCTCGTTCTGCTAATAGAG No data
Right 979112032 4:116770876-116770898 GGAAAAACATTCCATGCTCATGG 0: 2077
1: 12734
2: 6989
3: 4447
4: 3846
979112027_979112033 27 Left 979112027 4:116770831-116770853 CCCTCCTCGTTCTGCTAATAGAG No data
Right 979112033 4:116770881-116770903 AACATTCCATGCTCATGGATTGG 0: 4386
1: 11539
2: 6287
3: 4095
4: 3440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979112027 Original CRISPR CTCTATTAGCAGAACGAGGA GGG (reversed) Intergenic
No off target data available for this crispr