ID: 979113999

View in Genome Browser
Species Human (GRCh38)
Location 4:116797675-116797697
Sequence ACATTCTGACATAAGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979113999_979114002 -7 Left 979113999 4:116797675-116797697 CCTCATTCCTTATGTCAGAATGT No data
Right 979114002 4:116797691-116797713 AGAATGTGGAAGTTACCTCCAGG No data
979113999_979114006 20 Left 979113999 4:116797675-116797697 CCTCATTCCTTATGTCAGAATGT No data
Right 979114006 4:116797718-116797740 CCTTCCTACTCCAACAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979113999 Original CRISPR ACATTCTGACATAAGGAATG AGG (reversed) Intergenic
No off target data available for this crispr