ID: 979115140

View in Genome Browser
Species Human (GRCh38)
Location 4:116814375-116814397
Sequence CTTATAAGGTCCCCAGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979115136_979115140 12 Left 979115136 4:116814340-116814362 CCTGTTTCTGTGTCCCGGTGTCT No data
Right 979115140 4:116814375-116814397 CTTATAAGGTCCCCAGTAATTGG No data
979115137_979115140 -1 Left 979115137 4:116814353-116814375 CCCGGTGTCTTAACATGTATTTC No data
Right 979115140 4:116814375-116814397 CTTATAAGGTCCCCAGTAATTGG No data
979115138_979115140 -2 Left 979115138 4:116814354-116814376 CCGGTGTCTTAACATGTATTTCT No data
Right 979115140 4:116814375-116814397 CTTATAAGGTCCCCAGTAATTGG No data
979115135_979115140 13 Left 979115135 4:116814339-116814361 CCCTGTTTCTGTGTCCCGGTGTC No data
Right 979115140 4:116814375-116814397 CTTATAAGGTCCCCAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979115140 Original CRISPR CTTATAAGGTCCCCAGTAAT TGG Intergenic
No off target data available for this crispr