ID: 979118553

View in Genome Browser
Species Human (GRCh38)
Location 4:116861101-116861123
Sequence TTATCTGCCTAGTTTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979118551_979118553 5 Left 979118551 4:116861073-116861095 CCTGGCCTTCTCTGCATGCTTAC No data
Right 979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG No data
979118547_979118553 22 Left 979118547 4:116861056-116861078 CCCTCTAGTGCCAGCCTCCTGGC No data
Right 979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG No data
979118549_979118553 12 Left 979118549 4:116861066-116861088 CCAGCCTCCTGGCCTTCTCTGCA No data
Right 979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG No data
979118550_979118553 8 Left 979118550 4:116861070-116861092 CCTCCTGGCCTTCTCTGCATGCT No data
Right 979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG No data
979118552_979118553 0 Left 979118552 4:116861078-116861100 CCTTCTCTGCATGCTTACTTTTG No data
Right 979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG No data
979118548_979118553 21 Left 979118548 4:116861057-116861079 CCTCTAGTGCCAGCCTCCTGGCC No data
Right 979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979118553 Original CRISPR TTATCTGCCTAGTTTCAGTA AGG Intergenic
No off target data available for this crispr