ID: 979123055

View in Genome Browser
Species Human (GRCh38)
Location 4:116927052-116927074
Sequence CTGTATTACCTGAAGCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979123055_979123058 -3 Left 979123055 4:116927052-116927074 CCCCTGTGCTTCAGGTAATACAG No data
Right 979123058 4:116927072-116927094 CAGACTCCTGCCCTGACCACAGG No data
979123055_979123061 7 Left 979123055 4:116927052-116927074 CCCCTGTGCTTCAGGTAATACAG No data
Right 979123061 4:116927082-116927104 CCCTGACCACAGGTGATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979123055 Original CRISPR CTGTATTACCTGAAGCACAG GGG (reversed) Intergenic
No off target data available for this crispr