ID: 979124166

View in Genome Browser
Species Human (GRCh38)
Location 4:116946529-116946551
Sequence GGGAACTCACTTACATCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979124166_979124171 21 Left 979124166 4:116946529-116946551 CCCTCAGATGTAAGTGAGTTCCC No data
Right 979124171 4:116946573-116946595 GCTAGTTATTAAAAATAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979124166 Original CRISPR GGGAACTCACTTACATCTGA GGG (reversed) Intergenic
No off target data available for this crispr