ID: 979125708

View in Genome Browser
Species Human (GRCh38)
Location 4:116969397-116969419
Sequence CAAAATGCTAATAGTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979125708_979125710 4 Left 979125708 4:116969397-116969419 CCAATAGCACTATTAGCATTTTG No data
Right 979125710 4:116969424-116969446 AAACCATTTAACAAGTCTCTAGG 0: 17
1: 457
2: 2219
3: 2110
4: 1328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979125708 Original CRISPR CAAAATGCTAATAGTGCTAT TGG (reversed) Intergenic
No off target data available for this crispr