ID: 979126607

View in Genome Browser
Species Human (GRCh38)
Location 4:116980760-116980782
Sequence CCCAGCGGGTACCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979126607_979126614 -9 Left 979126607 4:116980760-116980782 CCGGACTCGGGGTACCCGCTGGG No data
Right 979126614 4:116980774-116980796 CCCGCTGGGTGGTGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979126607 Original CRISPR CCCAGCGGGTACCCCGAGTC CGG (reversed) Intergenic
No off target data available for this crispr