ID: 979130268

View in Genome Browser
Species Human (GRCh38)
Location 4:117036118-117036140
Sequence GTGAGCTAGTAGAAGAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979130267_979130268 4 Left 979130267 4:117036091-117036113 CCATACTCTACTAAGAAAAAAGA No data
Right 979130268 4:117036118-117036140 GTGAGCTAGTAGAAGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979130268 Original CRISPR GTGAGCTAGTAGAAGAGTAA TGG Intergenic
No off target data available for this crispr