ID: 979136444

View in Genome Browser
Species Human (GRCh38)
Location 4:117117245-117117267
Sequence GGCTGTTGCAGGATTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979136438_979136444 -1 Left 979136438 4:117117223-117117245 CCCAATATCGGGGTATTATAAGG No data
Right 979136444 4:117117245-117117267 GGCTGTTGCAGGATTTAAGGAGG No data
979136440_979136444 -2 Left 979136440 4:117117224-117117246 CCAATATCGGGGTATTATAAGGG No data
Right 979136444 4:117117245-117117267 GGCTGTTGCAGGATTTAAGGAGG No data
979136437_979136444 0 Left 979136437 4:117117222-117117244 CCCCAATATCGGGGTATTATAAG No data
Right 979136444 4:117117245-117117267 GGCTGTTGCAGGATTTAAGGAGG No data
979136433_979136444 19 Left 979136433 4:117117203-117117225 CCTCACTGGGTTTTTGTAACCCC No data
Right 979136444 4:117117245-117117267 GGCTGTTGCAGGATTTAAGGAGG No data
979136432_979136444 24 Left 979136432 4:117117198-117117220 CCAGTCCTCACTGGGTTTTTGTA No data
Right 979136444 4:117117245-117117267 GGCTGTTGCAGGATTTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979136444 Original CRISPR GGCTGTTGCAGGATTTAAGG AGG Intergenic
No off target data available for this crispr