ID: 979137504

View in Genome Browser
Species Human (GRCh38)
Location 4:117127985-117128007
Sequence TGGTAGCATACCCATGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979137495_979137504 26 Left 979137495 4:117127936-117127958 CCAAGGTACAGCTTGGACCATTG No data
Right 979137504 4:117127985-117128007 TGGTAGCATACCCATGGTGTTGG No data
979137498_979137504 9 Left 979137498 4:117127953-117127975 CCATTGCTTCAGAGGGTGCAAGT 0: 26
1: 367
2: 958
3: 983
4: 864
Right 979137504 4:117127985-117128007 TGGTAGCATACCCATGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979137504 Original CRISPR TGGTAGCATACCCATGGTGT TGG Intergenic
No off target data available for this crispr