ID: 979138086

View in Genome Browser
Species Human (GRCh38)
Location 4:117135909-117135931
Sequence AGGTGGGCCTAGCATTATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979138079_979138086 25 Left 979138079 4:117135861-117135883 CCTTGAACATTACTCTGTGCTGC No data
Right 979138086 4:117135909-117135931 AGGTGGGCCTAGCATTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979138086 Original CRISPR AGGTGGGCCTAGCATTATAG TGG Intergenic
No off target data available for this crispr