ID: 979143191

View in Genome Browser
Species Human (GRCh38)
Location 4:117204575-117204597
Sequence TTAACTTTTTTATTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979143191_979143192 -8 Left 979143191 4:117204575-117204597 CCAGCAGCAAATAAAAAAGTTAA No data
Right 979143192 4:117204590-117204612 AAAGTTAATATACCATGATGAGG No data
979143191_979143193 -4 Left 979143191 4:117204575-117204597 CCAGCAGCAAATAAAAAAGTTAA No data
Right 979143193 4:117204594-117204616 TTAATATACCATGATGAGGTAGG No data
979143191_979143196 9 Left 979143191 4:117204575-117204597 CCAGCAGCAAATAAAAAAGTTAA No data
Right 979143196 4:117204607-117204629 ATGAGGTAGGCTTTATTCCAGGG No data
979143191_979143195 8 Left 979143191 4:117204575-117204597 CCAGCAGCAAATAAAAAAGTTAA No data
Right 979143195 4:117204606-117204628 GATGAGGTAGGCTTTATTCCAGG 0: 2
1: 10
2: 148
3: 654
4: 1808
979143191_979143197 21 Left 979143191 4:117204575-117204597 CCAGCAGCAAATAAAAAAGTTAA No data
Right 979143197 4:117204619-117204641 TTATTCCAGGGATATAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979143191 Original CRISPR TTAACTTTTTTATTTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr