ID: 979146637

View in Genome Browser
Species Human (GRCh38)
Location 4:117254433-117254455
Sequence GGCTCCACACAGATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979146637_979146641 -9 Left 979146637 4:117254433-117254455 CCATGTCCCATCTGTGTGGAGCC No data
Right 979146641 4:117254447-117254469 TGTGGAGCCCCACTGGAAATCGG No data
979146637_979146645 9 Left 979146637 4:117254433-117254455 CCATGTCCCATCTGTGTGGAGCC No data
Right 979146645 4:117254465-117254487 ATCGGACTGTTCAACTCACCTGG 0: 315
1: 324
2: 125
3: 60
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979146637 Original CRISPR GGCTCCACACAGATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr