ID: 979152166

View in Genome Browser
Species Human (GRCh38)
Location 4:117332764-117332786
Sequence TGGACATGAATAAATCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979152166_979152169 0 Left 979152166 4:117332764-117332786 CCCATAGGATTTATTCATGTCCA No data
Right 979152169 4:117332787-117332809 TTACACAGATCAATCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979152166 Original CRISPR TGGACATGAATAAATCCTAT GGG (reversed) Intergenic
No off target data available for this crispr