ID: 979153686 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:117354735-117354757 |
Sequence | CTGATTGTATACAAGGAGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
979153680_979153686 | 18 | Left | 979153680 | 4:117354694-117354716 | CCACAATTCATTCTAGAACTGTG | No data | ||
Right | 979153686 | 4:117354735-117354757 | CTGATTGTATACAAGGAGCAGGG | No data | ||||
979153679_979153686 | 19 | Left | 979153679 | 4:117354693-117354715 | CCCACAATTCATTCTAGAACTGT | No data | ||
Right | 979153686 | 4:117354735-117354757 | CTGATTGTATACAAGGAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
979153686 | Original CRISPR | CTGATTGTATACAAGGAGCA GGG | Intergenic | ||
No off target data available for this crispr |