ID: 979153686

View in Genome Browser
Species Human (GRCh38)
Location 4:117354735-117354757
Sequence CTGATTGTATACAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979153680_979153686 18 Left 979153680 4:117354694-117354716 CCACAATTCATTCTAGAACTGTG No data
Right 979153686 4:117354735-117354757 CTGATTGTATACAAGGAGCAGGG No data
979153679_979153686 19 Left 979153679 4:117354693-117354715 CCCACAATTCATTCTAGAACTGT No data
Right 979153686 4:117354735-117354757 CTGATTGTATACAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979153686 Original CRISPR CTGATTGTATACAAGGAGCA GGG Intergenic
No off target data available for this crispr