ID: 979153812

View in Genome Browser
Species Human (GRCh38)
Location 4:117356695-117356717
Sequence CTTTGTAAGGCCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979153805_979153812 -8 Left 979153805 4:117356680-117356702 CCTGTAATCCCAGCACTTTGTAA 0: 67
1: 12455
2: 313856
3: 264775
4: 144378
Right 979153812 4:117356695-117356717 CTTTGTAAGGCCAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979153812 Original CRISPR CTTTGTAAGGCCAAGGTGGG TGG Intergenic
No off target data available for this crispr