ID: 979154429

View in Genome Browser
Species Human (GRCh38)
Location 4:117365233-117365255
Sequence GAGGCAGTCAACTTTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979154425_979154429 26 Left 979154425 4:117365184-117365206 CCAGCTCTCTAATATGAGTTGAT No data
Right 979154429 4:117365233-117365255 GAGGCAGTCAACTTTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979154429 Original CRISPR GAGGCAGTCAACTTTGCTAC TGG Intergenic
No off target data available for this crispr