ID: 979158155

View in Genome Browser
Species Human (GRCh38)
Location 4:117424499-117424521
Sequence TAATCAAGGCAGCATGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979158155_979158160 8 Left 979158155 4:117424499-117424521 CCAGTGCCATGCTGCCTTGATTA No data
Right 979158160 4:117424530-117424552 TTGTAATATGGTTTGAAGTCAGG No data
979158155_979158158 -4 Left 979158155 4:117424499-117424521 CCAGTGCCATGCTGCCTTGATTA No data
Right 979158158 4:117424518-117424540 ATTACTGTAGCCTTGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979158155 Original CRISPR TAATCAAGGCAGCATGGCAC TGG (reversed) Intergenic