ID: 979158581

View in Genome Browser
Species Human (GRCh38)
Location 4:117429599-117429621
Sequence GAGTTGCCCTGAGCCCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979158574_979158581 11 Left 979158574 4:117429565-117429587 CCTGCACAGACATACACCAACAG No data
Right 979158581 4:117429599-117429621 GAGTTGCCCTGAGCCCAGGCGGG No data
979158573_979158581 15 Left 979158573 4:117429561-117429583 CCTGCCTGCACAGACATACACCA No data
Right 979158581 4:117429599-117429621 GAGTTGCCCTGAGCCCAGGCGGG No data
979158578_979158581 -5 Left 979158578 4:117429581-117429603 CCAACAGAGCAATCTGGGGAGTT No data
Right 979158581 4:117429599-117429621 GAGTTGCCCTGAGCCCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979158581 Original CRISPR GAGTTGCCCTGAGCCCAGGC GGG Intergenic
No off target data available for this crispr