ID: 979159285

View in Genome Browser
Species Human (GRCh38)
Location 4:117438416-117438438
Sequence AATTGTTTCTATACCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979159285_979159290 22 Left 979159285 4:117438416-117438438 CCAGAAAAGGTATAGAAACAATT No data
Right 979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG No data
979159285_979159286 -2 Left 979159285 4:117438416-117438438 CCAGAAAAGGTATAGAAACAATT No data
Right 979159286 4:117438437-117438459 TTTACCTCTAGAGCCTCTATAGG No data
979159285_979159287 -1 Left 979159285 4:117438416-117438438 CCAGAAAAGGTATAGAAACAATT No data
Right 979159287 4:117438438-117438460 TTACCTCTAGAGCCTCTATAGGG No data
979159285_979159291 29 Left 979159285 4:117438416-117438438 CCAGAAAAGGTATAGAAACAATT No data
Right 979159291 4:117438468-117438490 CTCTCCCAACACCTGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979159285 Original CRISPR AATTGTTTCTATACCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr