ID: 979159288

View in Genome Browser
Species Human (GRCh38)
Location 4:117438441-117438463
Sequence ACTCCCTATAGAGGCTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979159288_979159290 -3 Left 979159288 4:117438441-117438463 CCTCTAGAGCCTCTATAGGGAGT No data
Right 979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG No data
979159288_979159296 28 Left 979159288 4:117438441-117438463 CCTCTAGAGCCTCTATAGGGAGT No data
Right 979159296 4:117438492-117438514 TATCTGGCCATCAGAACTATTGG No data
979159288_979159294 12 Left 979159288 4:117438441-117438463 CCTCTAGAGCCTCTATAGGGAGT No data
Right 979159294 4:117438476-117438498 ACACCTGGATTTTGGATATCTGG No data
979159288_979159291 4 Left 979159288 4:117438441-117438463 CCTCTAGAGCCTCTATAGGGAGT No data
Right 979159291 4:117438468-117438490 CTCTCCCAACACCTGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979159288 Original CRISPR ACTCCCTATAGAGGCTCTAG AGG (reversed) Intergenic
No off target data available for this crispr