ID: 979159290

View in Genome Browser
Species Human (GRCh38)
Location 4:117438461-117438483
Sequence AGTACAGCTCTCCCAACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979159285_979159290 22 Left 979159285 4:117438416-117438438 CCAGAAAAGGTATAGAAACAATT No data
Right 979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG No data
979159284_979159290 29 Left 979159284 4:117438409-117438431 CCAAAAGCCAGAAAAGGTATAGA No data
Right 979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG No data
979159288_979159290 -3 Left 979159288 4:117438441-117438463 CCTCTAGAGCCTCTATAGGGAGT No data
Right 979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979159290 Original CRISPR AGTACAGCTCTCCCAACACC TGG Intergenic
No off target data available for this crispr